Mylacuteid Mylacuteid

English

Answered

with the knowledge of the factors affected by the shift in various speech situations i am able to

Sagot :

Rodenasrodjkurtangelid Rodenasrodjkurtangelid

Answer:

Identifies social situations in which each speech style is appropriate to use

I am able to express my feelings and emotions..

Without this i am not who i am.

Explanation:

Answer Link

ID Other Questions

For Each Solid Figure, Find The Correct Net Of Each. Encircle The Letter Of The Correct Net. b 의 b Sana May Sumagot

Report If Nagbuang Buang Og Answer How Did The American And French Revolutions Influence The Rise Of Nationalism Not Only In Europe But Also Around The World?

ARTS Direction: Put A Check (/) On The Space If The Statement Tells About The Advantages Of Screen Printing, Put (x) If Not. 6. Huge Range Of Printable Fabrics

Shopee Bat Ang Mahal!?

Ano-ano Ang Iba't-ibang Estratihiya Ang Pangangalap Ng Mga Datos O Impormasyon Sa Pagsulat.ASAP PO NEED PO TALAGA:)

- 1. This Is The Acid Percentage Of Fruit Juices.

Sa Tulong Ng Kasapi Ng Pamilya Magsagawa Ng Isang Survey Tungkol Sa Mga Programang Ipinatutupad Ng Pinuno Sa Inyong Barangay At Ang Epekto Nito Sa Inyo Isulat S

Ibigay Ang Iyong Opinyon Tungkol Sa Salitang Nasa Loob Ng Bilog Isulat Ang Iyong Sa Sagot Sa Loob Ng Parihaba (non Related Sa Question Or Nonsense=report)pls Wa

The Sequence Of DNA Is 5’ ATGCATAGATTAGGATATCCCAGATAG 3’. What Is The Sequence Of The Complimentary RNA Strand?(Pa Help Po Dito Please Pasahan Napo Kasi Mamaya)

TAYAHIN : AP Grade 10 Summative Test